View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13189_low_7 (Length: 236)
Name: NF13189_low_7
Description: NF13189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13189_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 72; Significance: 7e-33; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 18 - 109
Target Start/End: Original strand, 3428350 - 3428440
Alignment:
| Q |
18 |
gtttcatgttgttagagtttatggatagattgattaacgatagagaaaataatgatttttcatgaaattttaggttttccataaagttacaa |
109 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3428350 |
gtttcatgttattagagtttatggttagattgattaacaa-agagaaaataatgatttttcatgaaattttaggttttccataaagttacaa |
3428440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 145 - 216
Target Start/End: Original strand, 52490107 - 52490178
Alignment:
| Q |
145 |
ggtttgtgctccctggcagcagttttggcgctcacgttttgtgtggtgtggccggttttagccggttcctat |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||| | |||||| |
|
|
| T |
52490107 |
ggtttgtgctccctggcagcagttttggcgcccatgttttgtgtggtgtggccggttttagccagctcctat |
52490178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 145 - 216
Target Start/End: Complemental strand, 49991174 - 49991103
Alignment:
| Q |
145 |
ggtttgtgctccctggcagcagttttggcgctcacgttttgtgtggtgtggccggttttagccggttcctat |
216 |
Q |
| |
|
|||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
49991174 |
ggtttgtgctccttggcagcagttttggcgcccacgttttgtgtggtgtggccggttttagccagctcctat |
49991103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University