View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1318_high_116 (Length: 255)
Name: NF1318_high_116
Description: NF1318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1318_high_116 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 34 - 232
Target Start/End: Original strand, 20716777 - 20716975
Alignment:
| Q |
34 |
tctaaatcagccacaatttttattcctgattttgtttgcatcatttcatcagagcactcgggcacaatgtgtgatggcagtgcatccacggcgataaggg |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20716777 |
tctaaatcagccacaatttttattcctgattttgtttgcatcatttcatcagagcactcgggcacaatgtgtgatggcagtgcatccacggcgataaggg |
20716876 |
T |
 |
| Q |
134 |
ttaacctgatctctgtggttgcaatcgtagtatgattgtcccttaagaccacatgggatactatcagccagaagggcatcatagctaatgtatcttctt |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20716877 |
ttaacctgatctctgtggttgcaatcgtagtatgattgtcccttaagaccacatgggatactatcagccagaagggcatcatagctaatgtatcttctt |
20716975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 97; Significance: 9e-48; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 49 - 233
Target Start/End: Complemental strand, 35294291 - 35294107
Alignment:
| Q |
49 |
atttttattcctgattttgtttgcatcatttcatcagagcactcgggcacaatgtgtgatggcagtgcatccacggcgataagggttaacctgatctctg |
148 |
Q |
| |
|
|||||| |||||||||||||||||| ||||| ||||||| || |||||||||||||||||||||||| |||||||| ||||||||| ||||| |||| |
|
|
| T |
35294291 |
atttttgttcctgattttgtttgcaccatttaatcagagtgttctggcacaatgtgtgatggcagtgcaaccacggcggtaagggttagcctgacctcta |
35294192 |
T |
 |
| Q |
149 |
tggttgcaatcgtagtatgattgtcccttaagaccacatgggatactatcagccagaagggcatcatagctaatgtatcttcttt |
233 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||||| ||| |||| ||||||| ||||||||||||||||||||| |
|
|
| T |
35294191 |
gcgttgcaatcgtagtaagattgtcccttttgaccacatgggatattattagccttaagggcaccatagctaatgtatcttcttt |
35294107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University