View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1318_high_128 (Length: 251)
Name: NF1318_high_128
Description: NF1318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1318_high_128 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 228; Significance: 1e-126; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 14743595 - 14743356
Alignment:
| Q |
1 |
aacatcgatgacaccgttgaattttacttcaatctcatcttcttctctgttggtggttcgtacttccctatctctcacttttccatccaaatatattatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14743595 |
aacatcgatgacaccgttgaattttacttcaatctcatcttcttctctgttggtggttcgtacttccctatctctcacttttccatccaaatatattatt |
14743496 |
T |
|
| Q |
101 |
attcttcatctcattcgtaaattatttaggtgtattttccctctttggcttctatgtcatatcaattgccctagcaagacgctgccacccttccgcgaag |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
14743495 |
attcttcatctcattcgtaaattatttaggtgtattttccctctttggcttctatgtcatatcaattgccctagcaagacgctgccacacttccgcgaag |
14743396 |
T |
|
| Q |
201 |
gtatattattagggttttacaacattcctttattattcat |
240 |
Q |
| |
|
|| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
14743395 |
gtgtattattagggttttacaacattccttttttattcat |
14743356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 172 - 240
Target Start/End: Complemental strand, 14746339 - 14746271
Alignment:
| Q |
172 |
tagcaagacgctgccacccttccgcgaaggtatattattagggttttacaacattcctttattattcat |
240 |
Q |
| |
|
|||||| ||||||| | ||||||||||||||||||||||| | |||||||||||||||| | |||||| |
|
|
| T |
14746339 |
tagcaaaacgctgctccacttccgcgaaggtatattattagcggtttacaacattcctttttaattcat |
14746271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University