View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1318_high_137 (Length: 247)
Name: NF1318_high_137
Description: NF1318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1318_high_137 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 216; Significance: 1e-119; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 5857014 - 5856782
Alignment:
| Q |
1 |
gaactaaactttgtcatttttaatgttcacttccactctctttttctttatgagaatttccaatggattttaatagagtactctagttcttgatgttatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5857014 |
gaactaaactttgtcatttttaatgttcacttccactctctttttctttatgagaatttccaatggattttaatagagtactctagttcttgatgttatc |
5856915 |
T |
 |
| Q |
101 |
aaaattgtgtctattgtcaacaaataaattactgttaataaatatgaaaatttggaataacacgacattgattagtacaaattaatagagtactcaatat |
200 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5856914 |
aaaattgtgtctattgccaacaaataaattactattaataaatatgaaaatttgga--aacacgacattgattagtacaaattaatagagtactcaatat |
5856817 |
T |
 |
| Q |
201 |
tgttttttcttctttacaaaagtccacttaatatt |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
5856816 |
tgttttttcttctttacaaaagtccacttaatatt |
5856782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 62
Target Start/End: Complemental strand, 5863807 - 5863745
Alignment:
| Q |
1 |
gaactaaactttgtcatttttaatgttcacttcc-actctctttttctttatgagaatttcca |
62 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
5863807 |
gaacttaactttgtcatttttaatgttcacttccaactctctttttctttatgagaatttcca |
5863745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University