View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1318_high_146 (Length: 230)
Name: NF1318_high_146
Description: NF1318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1318_high_146 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 72 - 230
Target Start/End: Complemental strand, 38875005 - 38874847
Alignment:
| Q |
72 |
agaacctgtgaacgaacaatagctgattctgctccaacaatttctgcaaaagcctggtcgagagcttcacgccccccagcttcatcatgaccataaccag |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
38875005 |
agaacctgtgaacgaacaatagctgattctgctccaacaatttctgcaaaagcctggtcaagagcttcacgccccccagtttcatcatgaccataaccag |
38874906 |
T |
 |
| Q |
172 |
tgcaaccaccaaagtgctgacagcattaacaaaataaccaattagggcatgtttagatt |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38874905 |
tgcaaccaccaaagtgctgacagcattaacaaaataaccaattagggcatgtttagatt |
38874847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University