View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1318_high_149 (Length: 218)
Name: NF1318_high_149
Description: NF1318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1318_high_149 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 138 - 188
Target Start/End: Original strand, 2794575 - 2794625
Alignment:
| Q |
138 |
gagatgaaggggtcgaatttggagtcaattttggaggagttatatgttgtg |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2794575 |
gagatgaaggggtcgaatttggagtcaattttggaggagttatatgctgtg |
2794625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University