View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1318_high_29 (Length: 494)
Name: NF1318_high_29
Description: NF1318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1318_high_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 95; Significance: 3e-46; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 145 - 366
Target Start/End: Complemental strand, 12985168 - 12984943
Alignment:
| Q |
145 |
aggttgattcccccactcacttctcggacgtttcaaagattggtacctagaccaaacaacagcaacaa-----ctgaaaaatttgaacactttaaaagat |
239 |
Q |
| |
|
||||||| ||||||||| |||| ||||||||||||||||||||||| |||||||||||||| |||||| |||| ||||| |||||||||||||||| |
|
|
| T |
12985168 |
aggttgactcccccacttacttttcggacgtttcaaagattggtacatagaccaaacaacaacaacaacaactctgacaaattggaacactttaaaagat |
12985069 |
T |
 |
| Q |
240 |
aaatttgtcgcaagattattttctcaaagcataatttattatgctaatgcaacaattgatgtcttcactcaatgctccaatgaaacattgtgtaaagcat |
339 |
Q |
| |
|
|| ||| | | |||||||||| ||| ||||| |||||||||||| |||| ||||||||||||||||||||| |||||| ||||| ||||||| |||||| |
|
|
| T |
12985068 |
aagtttattggaagattatttcctcggagcatgatttattatgct-atgccacaattgatgtcttcactcaaagctccagtgaaatattgtgtgaagcat |
12984970 |
T |
 |
| Q |
340 |
gggagcaataaaaatctatgctcctta |
366 |
Q |
| |
|
|| | | ||| |||| | ||||||||| |
|
|
| T |
12984969 |
ggaaacgatacaaatttgtgctcctta |
12984943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 365 - 466
Target Start/End: Original strand, 19728437 - 19728539
Alignment:
| Q |
365 |
taaatgtccgaacaatgaatttgacgacataactcaaatcgatatctttagaaattttctt-agcagcaacataaacttatgctagatgtaactgcatgt |
463 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
19728437 |
taaatgtacgaacaatgaatttgacgacataactcaaatcgatatctttagaaattttcttcagcagcaacataaacttatgctagatgtaactgaatgt |
19728536 |
T |
 |
| Q |
464 |
agt |
466 |
Q |
| |
|
||| |
|
|
| T |
19728537 |
agt |
19728539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 94 - 137
Target Start/End: Complemental strand, 12985247 - 12985204
Alignment:
| Q |
94 |
cccattaactatcttggaagatttatgagaaagttgaatccctc |
137 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
12985247 |
cccattaactatcttgaaagatttatgagatagttgaatccctc |
12985204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 336 - 367
Target Start/End: Original strand, 19727740 - 19727771
Alignment:
| Q |
336 |
gcatgggagcaataaaaatctatgctccttaa |
367 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
19727740 |
gcatgggagcaataaaaatctatgctccttaa |
19727771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University