View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1318_high_68 (Length: 360)

Name: NF1318_high_68
Description: NF1318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1318_high_68
NF1318_high_68
[»] chr4 (3 HSPs)
chr4 (13-340)||(27447935-27448261)
chr4 (13-124)||(27460286-27460396)
chr4 (13-66)||(48709435-48709488)


Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 13 - 340
Target Start/End: Original strand, 27447935 - 27448261
Alignment:
13 atcataggtaatggggaaaatatcattttttggcttgatccctggcttgacaaatctgttgcttttattcttaacttgccaggcaacgttcatagcagtt 112  Q
    ||||||||||||||||||||||||| ||||||||||||||| |||||||||||  ||||||||| |||||||||||||||||||||| ||||||| ||||    
27447935 atcataggtaatggggaaaatatcaatttttggcttgatccgtggcttgacaac-ctgttgcttctattcttaacttgccaggcaacattcatagtagtt 27448033  T
113 taatagatagggnnnnnnnnnnnnnactggcacttccctcaacatgttttggactctttccctaacctgaatcaacttgtcatgcaagtatctctcccca 212  Q
    ||||||||||||             || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |    
27448034 taatagatagggtttctgattttttaccggcacttccctcaacatgttttggactctttccctaacctgaatcaacttgtcatgcaagtaactctcccta 27448133  T
213 gtgagcctaaggaagacaaattagtttggaaaagaaactcaacatgagatctttctattaaggaggctttttcattcaaatatggcacatgacaaaatat 312  Q
    |||||||||||||||||||||||||||||||||||  || |||| ||||||||||| |||| ||||||||||||||||||||||||||| ||||||||||    
27448134 gtgagcctaaggaagacaaattagtttggaaaagatgctaaacaggagatctttctcttaaagaggctttttcattcaaatatggcacaggacaaaatat 27448233  T
313 ttcttgggcaaaaactctacggtgccct 340  Q
    ||||||||||||||| ||| ||||||||    
27448234 ttcttgggcaaaaacgctatggtgccct 27448261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 13 - 124
Target Start/End: Original strand, 27460286 - 27460396
Alignment:
13 atcataggtaatggggaaaatatcattttttggcttgatccctggcttgacaaatctgttgcttttattcttaacttgccaggcaacgttcatagcagtt 112  Q
    ||||||||||||||||||||||||| ||||||||||||||| ||||||||| || ||||||||| |||||||||||||||||||||| ||||||| ||||    
27460286 atcataggtaatggggaaaatatcaatttttggcttgatccgtggcttgac-aacctgttgcttctattcttaacttgccaggcaacattcatagtagtt 27460384  T
113 taatagataggg 124  Q
    ||||||||||||    
27460385 taatagataggg 27460396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 13 - 66
Target Start/End: Original strand, 48709435 - 48709488
Alignment:
13 atcataggtaatggggaaaatatcattttttggcttgatccctggcttgacaaa 66  Q
    |||||||||||||| || ||||| | ||||||||||||| ||||| ||||||||    
48709435 atcataggtaatggagagaatattaatttttggcttgatacctggattgacaaa 48709488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University