View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1318_high_69 (Length: 359)
Name: NF1318_high_69
Description: NF1318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1318_high_69 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 171; Significance: 9e-92; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 171; E-Value: 9e-92
Query Start/End: Original strand, 101 - 283
Target Start/End: Complemental strand, 19259688 - 19259506
Alignment:
| Q |
101 |
atctgtctatctttcaacttcttcccaaaggcaaccatctcttcctgcaatcatcgaaaacggcttttctcaatgaaagtaaattaaatcaataaccaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19259688 |
atctgtctatctttcaacttcttcccaaaggcaaccatctcttcctgcaatcatcgaaaacggcttttctcaatgaaagtaaattaaatcaataaccaat |
19259589 |
T |
 |
| Q |
201 |
taaaaatggtctctcaaacaaggtgtttgaactcaagtggttaataagtttcagttaaggtttgaatccggacaagaataatc |
283 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
19259588 |
taaaaatggtctctcaaacgaggtgtttgaactcaagtggttaataagtttcagttaaggtttgaatccgggcaaaaataatc |
19259506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University