View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1318_high_71 (Length: 359)
Name: NF1318_high_71
Description: NF1318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1318_high_71 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 14 - 339
Target Start/End: Original strand, 27447937 - 27448261
Alignment:
| Q |
14 |
cataggtaatggggaaaatatcattttttggcttgatccctggcttgacaaatctgttgcttttattcttaacttgccaggcaacgttcatagcagttta |
113 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| ||||||||||| ||||||||| |||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
27447937 |
cataggtaatggggaaaatatcaatttttggcttgatccgtggcttgacaac-ctgttgcttctattcttaacttgccaggcaacattcatagtagttta |
27448035 |
T |
|
| Q |
114 |
atagatagggnnnnnnnnnnnnnactggcacttccctcaacatgttttggactctttccctaacctgaatcaacttgtcatgcaagtatctctccccagt |
213 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||| |
|
|
| T |
27448036 |
atagatagggtttctgattttttaccggcacttccctcaacatgttttggactctttccctaacctgaatcaacttgtcatgcaagtaactctccctagt |
27448135 |
T |
|
| Q |
214 |
gagcctaaggaagacaaattagtttggaaaagaaactcaacatgagatctttctattaaggaggctttttcattcaaatatggcacatgacaaaatattt |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || |||| ||||||||||| |||| ||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
27448136 |
gagcctaaggaagacaaattagtttggaaaagatgctaaacaggagatctttctcttaaagaggctttttcattcaaatatggcacaggacaaaatattt |
27448235 |
T |
|
| Q |
314 |
cttgggcaaaaactctacggtgccct |
339 |
Q |
| |
|
||||||||||||| ||| |||||||| |
|
|
| T |
27448236 |
cttgggcaaaaacgctatggtgccct |
27448261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 14 - 123
Target Start/End: Original strand, 27460288 - 27460396
Alignment:
| Q |
14 |
cataggtaatggggaaaatatcattttttggcttgatccctggcttgacaaatctgttgcttttattcttaacttgccaggcaacgttcatagcagttta |
113 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| ||||||||||| ||||||||| |||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
27460288 |
cataggtaatggggaaaatatcaatttttggcttgatccgtggcttgacaac-ctgttgcttctattcttaacttgccaggcaacattcatagtagttta |
27460386 |
T |
|
| Q |
114 |
atagataggg |
123 |
Q |
| |
|
|||||||||| |
|
|
| T |
27460387 |
atagataggg |
27460396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University