View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1318_high_71 (Length: 359)

Name: NF1318_high_71
Description: NF1318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1318_high_71
NF1318_high_71
[»] chr4 (2 HSPs)
chr4 (14-339)||(27447937-27448261)
chr4 (14-123)||(27460288-27460396)


Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 14 - 339
Target Start/End: Original strand, 27447937 - 27448261
Alignment:
14 cataggtaatggggaaaatatcattttttggcttgatccctggcttgacaaatctgttgcttttattcttaacttgccaggcaacgttcatagcagttta 113  Q
    ||||||||||||||||||||||| ||||||||||||||| |||||||||||  ||||||||| |||||||||||||||||||||| ||||||| ||||||    
27447937 cataggtaatggggaaaatatcaatttttggcttgatccgtggcttgacaac-ctgttgcttctattcttaacttgccaggcaacattcatagtagttta 27448035  T
114 atagatagggnnnnnnnnnnnnnactggcacttccctcaacatgttttggactctttccctaacctgaatcaacttgtcatgcaagtatctctccccagt 213  Q
    ||||||||||             || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||    
27448036 atagatagggtttctgattttttaccggcacttccctcaacatgttttggactctttccctaacctgaatcaacttgtcatgcaagtaactctccctagt 27448135  T
214 gagcctaaggaagacaaattagtttggaaaagaaactcaacatgagatctttctattaaggaggctttttcattcaaatatggcacatgacaaaatattt 313  Q
    |||||||||||||||||||||||||||||||||  || |||| ||||||||||| |||| ||||||||||||||||||||||||||| ||||||||||||    
27448136 gagcctaaggaagacaaattagtttggaaaagatgctaaacaggagatctttctcttaaagaggctttttcattcaaatatggcacaggacaaaatattt 27448235  T
314 cttgggcaaaaactctacggtgccct 339  Q
    ||||||||||||| ||| ||||||||    
27448236 cttgggcaaaaacgctatggtgccct 27448261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 14 - 123
Target Start/End: Original strand, 27460288 - 27460396
Alignment:
14 cataggtaatggggaaaatatcattttttggcttgatccctggcttgacaaatctgttgcttttattcttaacttgccaggcaacgttcatagcagttta 113  Q
    ||||||||||||||||||||||| ||||||||||||||| |||||||||||  ||||||||| |||||||||||||||||||||| ||||||| ||||||    
27460288 cataggtaatggggaaaatatcaatttttggcttgatccgtggcttgacaac-ctgttgcttctattcttaacttgccaggcaacattcatagtagttta 27460386  T
114 atagataggg 123  Q
    ||||||||||    
27460387 atagataggg 27460396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University