View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1318_high_76 (Length: 337)
Name: NF1318_high_76
Description: NF1318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1318_high_76 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 5e-87; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 5e-87
Query Start/End: Original strand, 85 - 283
Target Start/End: Complemental strand, 12275407 - 12275210
Alignment:
| Q |
85 |
aaaaatgtcactcaaaagagctaccatggcatgcatacattcattggacaactgccatgtgtgcttttaacattgacttggtatttgtccgtttaacata |
184 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
12275407 |
aaaaatgtcactcaaaaaagctaccatggcatgcatacattcattggacaactgccatgtgtgcttttaacattgacttggtatttgtccggttagcata |
12275308 |
T |
 |
| Q |
185 |
tgaatgttatattgcagggactaattctcatattcgatcatattacagggattaaaaatatatataacttgaaaataaactaccatgaaaatacaatga |
283 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||||||||||||||| |||||||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
12275307 |
tgaatgtcatattgcagggactaattcccatattcgatcatattaca-ggattaaaaacatatataacttgaaaataaactaacatgaaaatacaatga |
12275210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 129 - 276
Target Start/End: Complemental strand, 14260939 - 14260792
Alignment:
| Q |
129 |
tggacaactgccatgtgtgcttttaacattgacttggtatttgtccgtttaacatatgaatgttatattgcagggactaattctcatattcgatcatatt |
228 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||||| ||| || ||| |||| ||||||||||||||||| | | ||||| ||||||| |
|
|
| T |
14260939 |
tggacaactgtcacgtgtgcttttaacattgacttggtatttgtccaattagcagatgtatgtcatattgcagggactaatacccgtattcactcatatt |
14260840 |
T |
 |
| Q |
229 |
acagggattaaaaatatatataacttgaaaataaactaccatgaaaat |
276 |
Q |
| |
|
| |||||| ||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
14260839 |
atagggataaaaaacatatataactcgaaaataaactaccatgaaaat |
14260792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University