View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1318_low_101 (Length: 310)
Name: NF1318_low_101
Description: NF1318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1318_low_101 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 9 - 282
Target Start/End: Original strand, 37436862 - 37437130
Alignment:
| Q |
9 |
attattcttttaggagaaacacagtgtgaaaattttctttaatgttgttgtttgtttgctaaattatgtattgtataggttggagcgaataaacccagat |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37436862 |
attattcttttaggagaaacacagtgtgaaaattttctttaatgttgttgtttgtttgctaaattatgtattgtataggttggagcgaataaacccagat |
37436961 |
T |
|
| Q |
109 |
tgccctgttactaccttgccacaatgtaagcccactgataactgcctcgctaaggttataaaggtctcacgtgcttagctaatttcaaagacatttgttt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37436962 |
tgccctgttactaccttgccacaatgtaagcccactgataactgcctcgctaaggttataaaggtctcacgtgcttagctaatttcaaagacatttgttt |
37437061 |
T |
|
| Q |
209 |
tataaatctgcggttgcttctcttatatatgttccaactggaatcatgaatttttctagtttattgttgttttt |
282 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37437062 |
tataaatctgcggttgcttctct----tatgttccaactggaatcatgaatttttctag-ttattgttgttttt |
37437130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University