View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1318_low_116 (Length: 276)
Name: NF1318_low_116
Description: NF1318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1318_low_116 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 49 - 263
Target Start/End: Complemental strand, 8936433 - 8936218
Alignment:
| Q |
49 |
ggttttgcctgactt-gtaatgtttttctttatatgtgtatggtagatgcatgtctcctttagatggtgatctatgatggtagatgcaataccaaagacg |
147 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
8936433 |
ggttttgcctgactttgtaatgtttttctttatatgtgtatggttgatgcatgtctcctttagatggtgatctatgatggtagatgcaacaccaaagacg |
8936334 |
T |
 |
| Q |
148 |
tggtcgtagttaggttctcttcttagacatgcatgtgggtgtcttagatatgaaaaactaatttgtatatggtagatgcatgtcggtgtaagatttcttc |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8936333 |
tggtcgtagttaggttctcttcttagacatgcatgtgggtgtcttaaatatgaaaaactaatttgtatatggtagatgcatgtcggtgtaagatttcttc |
8936234 |
T |
 |
| Q |
248 |
cctatatacacaccct |
263 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
8936233 |
cctatatacacaccct |
8936218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University