View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1318_low_120 (Length: 271)
Name: NF1318_low_120
Description: NF1318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1318_low_120 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 30 - 223
Target Start/End: Complemental strand, 43802387 - 43802188
Alignment:
| Q |
30 |
acaatatccaagtaacttaactttgacaaatcattttcttctactaatttcttcgccccaaccacgttatctagctcttgttggagatttttcatcactc |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43802387 |
acaatatccaagtaacttaactttgacaaatcattttcttctactaatttgttcgccccaaccacgttatctagctcttgttggagatttttcatcactc |
43802288 |
T |
 |
| Q |
130 |
ttggatgcctcatgagctctgacaaagccc------tagctgttgcggaagtttcaaatgccccggcaatcatgtctagggatatagcctttatgtttgt |
223 |
Q |
| |
|
|||||||||||||||||||||| ||||||| | | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43802287 |
ttggatgcctcatgagctctgataaagcccactccacaaccgttgcggaagtttcaaatgccccggcaatcatgtctagggatatagcctttatgtttgt |
43802188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 30 - 223
Target Start/End: Complemental strand, 43812956 - 43812757
Alignment:
| Q |
30 |
acaatatccaagtaacttaactttgacaaatcattttcttctactaatttcttcgccccaaccacgttatctagctcttgttggagatttttcatcactc |
129 |
Q |
| |
|
|||||||| |||||||||||||||| || |||||| || || |||||||| ||| |||||| || |||| ||||||||||||||||||||||| |||| |
|
|
| T |
43812956 |
acaatatctaagtaacttaactttgccatatcattctcctccactaatttgttcatcccaactacactatccagctcttgttggagatttttcattactc |
43812857 |
T |
 |
| Q |
130 |
ttggatgcctcatgagctctgacaaagccc------tagctgttgcggaagtttcaaatgccccggcaatcatgtctagggatatagcctttatgtttgt |
223 |
Q |
| |
|
||||||||||||||||||| || ||||||| | ||||| ||||| ||||||||| |||| |||||||||| || |||||||||||||||||| |
|
|
| T |
43812856 |
ttggatgcctcatgagctcggataaagcccactccacaatggttgcagaagtgtcaaatgccgcggcgatcatgtctaaggctatagcctttatgtttgt |
43812757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University