View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1318_low_122 (Length: 270)
Name: NF1318_low_122
Description: NF1318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1318_low_122 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 86; Significance: 4e-41; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 76 - 177
Target Start/End: Original strand, 20380995 - 20381096
Alignment:
| Q |
76 |
aaacagacatgaaaaggagaatggagaaacaaaattaaaagtataagactcatgagacagacattgcaagtgacattcattcaaagtatatgactcatga |
175 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20380995 |
aaacagacattcaaaggagaattgagaaacaaaattcaaagtataagactcatgagacagacattgcaagtgacattcattcaaagtatatgactcatga |
20381094 |
T |
 |
| Q |
176 |
ga |
177 |
Q |
| |
|
|| |
|
|
| T |
20381095 |
ga |
20381096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University