View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1318_low_131 (Length: 259)
Name: NF1318_low_131
Description: NF1318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1318_low_131 |
 | |
|
| [»] scaffold0129 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0129 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: scaffold0129
Description:
Target: scaffold0129; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 117 - 181
Target Start/End: Original strand, 30323 - 30387
Alignment:
| Q |
117 |
ttaggtttttactacaaattcatggcagcaccttaatgctacataatcttctatgatgatatatt |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30323 |
ttaggtttttactacaaattcatggcagcaccttaatgctacataatcttctatgatgatatatt |
30387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University