View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1318_low_135 (Length: 254)
Name: NF1318_low_135
Description: NF1318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1318_low_135 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 155 - 244
Target Start/End: Original strand, 6320455 - 6320545
Alignment:
| Q |
155 |
gtgccatcatataattacaaattgattagtagtatgatag-atacagaataagaatatgaaattgaatagtagtttaattatatttctgtg |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6320455 |
gtgccatcatataattacaaattgattagtagtatgagaggatacagaataagaatatgaaattgaatagtagtttaattatatttctgtg |
6320545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 29
Target Start/End: Original strand, 6320295 - 6320323
Alignment:
| Q |
1 |
ttatgatgtggtaatatgattgcaatatc |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6320295 |
ttatgatgtggtaatatgattgcaatatc |
6320323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University