View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1318_low_144 (Length: 251)
Name: NF1318_low_144
Description: NF1318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1318_low_144 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 15 - 251
Target Start/End: Complemental strand, 10522108 - 10521872
Alignment:
| Q |
15 |
actactatcttagacgagggaatttaaatcccttggactgtttaggttgattttctgcttttcaggtcattaatggttaaattgttgacagttccagccc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10522108 |
actactatcttagacgagggaatttaaatcccttggactgtttaggttgattttctgcttttcaggtcattaatggttaaattgttgacagttccagccc |
10522009 |
T |
 |
| Q |
115 |
ttaagttggtgggaacttttcggtgtgatattatgtgttggttctttaactttcaggagttttggtaagaggtaagagaatccggctggattagtgagcc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
10522008 |
ttaagttggtgggaacttttcggtgtgatattatgtgttggttctttaactttcaggagttttggtaagaggtaagagaatccggcaggattagtgagcc |
10521909 |
T |
 |
| Q |
215 |
gcaattgcagagatcgattttcatctgcaattgcatt |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10521908 |
gcaattgcagagatcgattttcatctgcaattgcatt |
10521872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University