View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1318_low_149 (Length: 251)
Name: NF1318_low_149
Description: NF1318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1318_low_149 |
 |  |
|
| [»] scaffold0013 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0013 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: scaffold0013
Description:
Target: scaffold0013; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 38989 - 38747
Alignment:
| Q |
1 |
aatgattgtattgaatatgttgtcacaggtgtccacttctaagacgattagtcttcgtatcttggaacagaatcaacaaagtggtaatgcgaaaggctat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38989 |
aatgattgtattgaatatgttgtcacaggtgtccacttctaagacgattagtcttcgtatcttggaacagaatcaacaaagtggtaatgcgaaaggctat |
38890 |
T |
 |
| Q |
101 |
tatgggatggaaagatctagagtcaatgacaatgcctaccatagaatatccaaattatatttttcaagaaatttcaaggagttgcaagaaattcagagaa |
200 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38889 |
taaaggatggaaagatctagagtcaatgacaatgcctaccatagaatatccaaattatatttttcaagaaatttcaaggagttgcaagaaattcagagaa |
38790 |
T |
 |
| Q |
201 |
ctcaaggttatgggacgtttaaatttgcaatttgcttcatctc |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38789 |
ctcaaggttatgggacgtttaaatttgcaatttgcttcatctc |
38747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 26 - 214
Target Start/End: Original strand, 45656078 - 45656266
Alignment:
| Q |
26 |
caggtgtccacttctaagacgattagtcttcgtatcttggaacagaatcaacaaagtggtaatgcgaaaggctattatgggatggaaagatctagagtca |
125 |
Q |
| |
|
||||||||||||| |||||||| ||||||| ||||| |||||| |||| || | | ||| ||| |||||||| |||| || ||||||||||| ||||| |
|
|
| T |
45656078 |
caggtgtccacttgtaagacgactagtctttgtatcgtggaaccgaataaaaagaatgggaattcgaaaggcaattagaggctggaaagatcttgagtct |
45656177 |
T |
 |
| Q |
126 |
atgacaatgcctaccatagaatatccaaattatatttttcaagaaatttcaaggagttgcaagaaattcagagaactcaaggttatggg |
214 |
Q |
| |
|
||||||||||| |||| | |||| ||| ||||| ||||||| |||| | ||||||||| || |||||||||||||||||||| |
|
|
| T |
45656178 |
atgacaatgccaggcatatataatccccgatatgtttttgaagaaatctcaaagcattgcaagaactttagagaactcaaggttatggg |
45656266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University