View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1318_low_153 (Length: 251)
Name: NF1318_low_153
Description: NF1318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1318_low_153 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 137 - 240
Target Start/End: Original strand, 39883558 - 39883659
Alignment:
| Q |
137 |
aaagtagcagtgaattcgattccaaagtatagtaaggaatatgattcaatgtggttataccaaatatttcttatttgcagcttgtacttgcaaacatcct |
236 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39883558 |
aaagtagcagtgaattcgattccaaagta--gtaaggaatatgattcaatgtggttataccaaatatttcttatttgcagcttgtacttgcaaacatcct |
39883655 |
T |
|
| Q |
237 |
tcat |
240 |
Q |
| |
|
|||| |
|
|
| T |
39883656 |
tcat |
39883659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 39883511 - 39883555
Alignment:
| Q |
1 |
cttaatatagatggatcatattttacgagcaacggaagctcgact |
45 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
39883511 |
cttaatatagatggatcatattttacgagtaacggaagctcgact |
39883555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 8 - 86
Target Start/End: Original strand, 42874765 - 42874843
Alignment:
| Q |
8 |
tagatggatcatattttacgagcaacggaagctcgacttatggtgctttggttcataatcaatatggtaaatttgtgtc |
86 |
Q |
| |
|
||||||||||||||||||| ||||| | ||||||| |||||||| |||| ||| | |||||| ||||||||||||||| |
|
|
| T |
42874765 |
tagatggatcatattttacaagcaatgaaagctcggcttatggtagtttgattcgtgatcaatttggtaaatttgtgtc |
42874843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 197 - 237
Target Start/End: Complemental strand, 40645110 - 40645070
Alignment:
| Q |
197 |
caaatatttcttatttgcagcttgtacttgcaaacatcctt |
237 |
Q |
| |
|
|||||||||||||| | || ||||||||||||||||||||| |
|
|
| T |
40645110 |
caaatatttcttatctacaacttgtacttgcaaacatcctt |
40645070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University