View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1318_low_159 (Length: 246)
Name: NF1318_low_159
Description: NF1318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1318_low_159 |
 |  |
|
| [»] scaffold0189 (2 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0189 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: scaffold0189
Description:
Target: scaffold0189; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 106 - 246
Target Start/End: Original strand, 20597 - 20737
Alignment:
| Q |
106 |
caggatgtactgctgtacaacttttttggcacttcaccattggaaaatcactggagggtgatttatgagtatatgaatgaacaagatatgctggaaccta |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20597 |
caggatgtactgctgtacaacttttttggcacttcaccattggaaaatcaatggagggtgatttatgagtatatgaatgaacaagatatgctggaaccta |
20696 |
T |
 |
| Q |
206 |
cagaatccaagtcttttcccagtttcaatgattccaaacac |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20697 |
cagaatccaagtcttttcccagtttcaatgattccaaacac |
20737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0189; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 9 - 52
Target Start/End: Original strand, 20500 - 20543
Alignment:
| Q |
9 |
agggcttgagtttcaggtagttaaaaaaccatcttgtctgattc |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20500 |
agggcttgagtttcaggtagttaaaaaaccatcttgtctgattc |
20543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University