View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1318_low_168 (Length: 235)
Name: NF1318_low_168
Description: NF1318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1318_low_168 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 10 - 131
Target Start/End: Original strand, 4292506 - 4292627
Alignment:
| Q |
10 |
caaacatatacagattgagttgagttggatttgtatattttgagataaaattcaaaacgaacagataaacaacaaattgaattggaccggattgattggg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4292506 |
caaacatatacagattgagttgagttggatttgtatattttgagataaaattcaaaacgaacagataaacaacaaattgaattggaccggattgattggg |
4292605 |
T |
 |
| Q |
110 |
taatcctactctatactctgtg |
131 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
4292606 |
taatcctactctatactctgtg |
4292627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University