View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1318_low_178 (Length: 201)

Name: NF1318_low_178
Description: NF1318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1318_low_178
NF1318_low_178
[»] chr8 (1 HSPs)
chr8 (1-122)||(947088-947209)


Alignment Details
Target: chr8 (Bit Score: 122; Significance: 8e-63; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 122; E-Value: 8e-63
Query Start/End: Original strand, 1 - 122
Target Start/End: Original strand, 947088 - 947209
Alignment:
1 tagttactaactttaattatgaatgtattaggcacaatgactcaattgcttggagttggtcaaagtgaatgctcacttatcatgtttgcaacttattcct 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
947088 tagttactaactttaattatgaatgtattaggcacaatgactcaattgcttggagttggtcaaagtgaatgctcacttatcatgtttgcaacttattcct 947187  T
101 ctgctccacttttacttaccct 122  Q
    ||||||||||||||||||||||    
947188 ctgctccacttttacttaccct 947209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University