View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1318_low_49 (Length: 416)
Name: NF1318_low_49
Description: NF1318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1318_low_49 |
 |  |
|
| [»] scaffold0189 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0189 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: scaffold0189
Description:
Target: scaffold0189; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 71 - 325
Target Start/End: Original strand, 21315 - 21569
Alignment:
| Q |
71 |
ggctgctggtcttagggcaactgcaaaccgtttacatgacttgaatcctgagaatgcaaaagaattcctcagcgaagctggtgaaatttttgaaagcata |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
21315 |
ggctgctggtcttagggcaactgcaaaccgtttacatgacttgaatcctgagaatgcaaatgcattcctcagggaagctggtgaaatttttgaaagcata |
21414 |
T |
 |
| Q |
171 |
ggaatggctgagtctgctgcccagtgtttttctgatttgggagattataaaagagcaggtatgaacttcagttttggcatctatatcattattatatggc |
270 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21415 |
ggaatggcggagtctgctgcccagtgtttttctgatttgggagattataaaagagcaggtatgaacttcagttttggcatctatatcattattatatggc |
21514 |
T |
 |
| Q |
271 |
attttctattgaaaaatgtaaggacatcattttagaacacaaatagcatgtttgt |
325 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21515 |
attttctattgaaaaatgtaaggacatcattttagaacacaaatagcatgtttgt |
21569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 73; Significance: 3e-33; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 79 - 251
Target Start/End: Original strand, 28395901 - 28396073
Alignment:
| Q |
79 |
gtcttagggcaactgcaaaccgtttacatgacttgaatcctgagaatgcaaaagaattcctcagcgaagctggtgaaatttttgaaagcataggaatggc |
178 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||||| ||| ||||||| | | |||| || ||||||| ||||||||||||| || | || |||| |
|
|
| T |
28395901 |
gtcttagggctactgcaatccgtttacatgacttgaatctggaggatgcaaacgcaatccttagggaagctgctgaaatttttgaaggccttggcatggt |
28396000 |
T |
 |
| Q |
179 |
tgagtctgctgcccagtgtttttctgatttgggagattataaaagagcaggtatgaacttcagttttggcatc |
251 |
Q |
| |
|
||| |||||||||||||||||| |||||||||| |||||| ||||||| ||||| ||||| | ||||||||| |
|
|
| T |
28396001 |
tgactctgctgcccagtgttttactgatttgggggattatgaaagagctggtataaactttaactttggcatc |
28396073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 59; Significance: 7e-25; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 6 - 64
Target Start/End: Original strand, 43802188 - 43802246
Alignment:
| Q |
6 |
acaaacataaaggctatatccctagacatgattgccggggcatttgaaacttccgcaac |
64 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43802188 |
acaaacataaaggctatatccctagacatgattgccggggcatttgaaacttccgcaac |
43802246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 6 - 64
Target Start/End: Original strand, 43812757 - 43812815
Alignment:
| Q |
6 |
acaaacataaaggctatatccctagacatgattgccggggcatttgaaacttccgcaac |
64 |
Q |
| |
|
|||||||||||||||||| || |||||||||| |||| ||||||||| ||||| ||||| |
|
|
| T |
43812757 |
acaaacataaaggctatagccttagacatgatcgccgcggcatttgacacttctgcaac |
43812815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University