View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1318_low_55 (Length: 401)
Name: NF1318_low_55
Description: NF1318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1318_low_55 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 156; Significance: 9e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 156; E-Value: 9e-83
Query Start/End: Original strand, 116 - 300
Target Start/End: Complemental strand, 14743666 - 14743483
Alignment:
| Q |
116 |
ttcttcgctcccttcaaatccctcttacatctcttttttcctgctctcgctgaatgcgnnnnnnnngttggcaacatcgatgacaccgttgaattttact |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
14743666 |
ttcttcgctcccttcaaatccctcttacatctcttttttcctgctctcgctgaatgcgaaaaaaa-gttggcaacatcgatgacaccgttgaattttact |
14743568 |
T |
 |
| Q |
216 |
tcaatctcatcttcttctctgttggtggttcgtacttccctatctctcacttttccatccaaatatattattattcttcatctca |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14743567 |
tcaatctcatcttcttctctgttggtggttcgtacttccctatctctcacttttccatccaaatatattattattcttcatctca |
14743483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University