View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1318_low_56 (Length: 401)

Name: NF1318_low_56
Description: NF1318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1318_low_56
NF1318_low_56
[»] chr5 (1 HSPs)
chr5 (116-300)||(14743483-14743666)


Alignment Details
Target: chr5 (Bit Score: 156; Significance: 9e-83; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 156; E-Value: 9e-83
Query Start/End: Original strand, 116 - 300
Target Start/End: Complemental strand, 14743666 - 14743483
Alignment:
116 ttcttcgctcccttcaaatccctcttacatctcttttttcctgctctcgctgaatgcgnnnnnnnngttggcaacatcgatgacaccgttgaattttact 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        ||||||||||||||||||||||||||||||||||    
14743666 ttcttcgctcccttcaaatccctcttacatctcttttttcctgctctcgctgaatgcgaaaaaaa-gttggcaacatcgatgacaccgttgaattttact 14743568  T
216 tcaatctcatcttcttctctgttggtggttcgtacttccctatctctcacttttccatccaaatatattattattcttcatctca 300  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14743567 tcaatctcatcttcttctctgttggtggttcgtacttccctatctctcacttttccatccaaatatattattattcttcatctca 14743483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University