View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1318_low_62 (Length: 393)
Name: NF1318_low_62
Description: NF1318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1318_low_62 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 164 - 393
Target Start/End: Complemental strand, 2656644 - 2656416
Alignment:
| Q |
164 |
ggtgtgagccagatgtccacgcataagactgtgtcgttgtctaaggatttgctaaagacaaaaaggatgacgattgaaaatttgattgaatcatctgagg |
263 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||| ||||||| |||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2656644 |
ggtgtgagccagatgtccac-cataagactgtgtcattgtctgaggatttcctaaagacgaaaaggatgacgattgaaaatttgattgaatcatctgagg |
2656546 |
T |
|
| Q |
264 |
tggtttatttatgtctcttatatgttaataagtttcaatttaaaatagacagttgaacaggtggaccaaataatcattactaattgatgatcattattat |
363 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
2656545 |
tggtttatttatgtctcttatatgttaataagtttcaatttaaaatagacagttgaacaagtggaccaaatgatcattactaattgatgatcattattat |
2656446 |
T |
|
| Q |
364 |
gcaggtatgtcaaggatttgttcttgcaac |
393 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
2656445 |
gcaggtatgtcaaggatttgttcttgcaac |
2656416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 21 - 66
Target Start/End: Complemental strand, 50234500 - 50234455
Alignment:
| Q |
21 |
ttattaaggaacgatgcagtaggaacttattttcctagagcttagg |
66 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
50234500 |
ttattaaggaatgatgcagtaggaacttattttcgtagagcttagg |
50234455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 25 - 66
Target Start/End: Original strand, 1448446 - 1448487
Alignment:
| Q |
25 |
taaggaacgatgcagtaggaacttattttcctagagcttagg |
66 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
1448446 |
taaggaatgatgcagtatgaacttattttcctagagcttagg |
1448487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 25 - 66
Target Start/End: Complemental strand, 46954130 - 46954089
Alignment:
| Q |
25 |
taaggaacgatgcagtaggaacttattttcctagagcttagg |
66 |
Q |
| |
|
||||||| |||| |||||||| |||||||||||||||||||| |
|
|
| T |
46954130 |
taaggaatgatggagtaggaatttattttcctagagcttagg |
46954089 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University