View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1318_low_66 (Length: 378)
Name: NF1318_low_66
Description: NF1318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1318_low_66 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 11 - 282
Target Start/End: Complemental strand, 47367287 - 47367016
Alignment:
| Q |
11 |
cacagatagtttgattcctagcaaagtttcaggaaaaatagtgatatgtgaccgaggaggaaatcctagagctgaaaagagtttggtggtcaaacgcgca |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47367287 |
cacagatagtttgattcctagcaaagtttcaggaaaaatagtgatatgtgaccgaggaggaaatcctagagctgaaaagagtttggtggtcaaacgcgca |
47367188 |
T |
 |
| Q |
111 |
ggaggaattgggatgattttagcaaacaaccaagattatggtgaagagctagttgctgactcctttctcctccctgcagcagctttgggagagaaagcaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47367187 |
ggaggaattgggatgattttagcaaacaaccaagattatggtgaagagctagttgctgactcctttctcctccctgcagcagctttgggagagaaagcaa |
47367088 |
T |
 |
| Q |
211 |
gcaatgaaataaagaagtatgcttcttcagctcccaatccaactgctaaaattgcatttggcggtacccggt |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47367087 |
gcaatgaaataaagaagtatgcttcttcagctcccaatccaactgctaaaattgcatttggcggtacccggt |
47367016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University