View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1318_low_75 (Length: 360)
Name: NF1318_low_75
Description: NF1318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1318_low_75 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 13 - 340
Target Start/End: Original strand, 27447935 - 27448261
Alignment:
| Q |
13 |
atcataggtaatggggaaaatatcattttttggcttgatccctggcttgacaaatctgttgcttttattcttaacttgccaggcaacgttcatagcagtt |
112 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| ||||||||||| ||||||||| |||||||||||||||||||||| ||||||| |||| |
|
|
| T |
27447935 |
atcataggtaatggggaaaatatcaatttttggcttgatccgtggcttgacaac-ctgttgcttctattcttaacttgccaggcaacattcatagtagtt |
27448033 |
T |
 |
| Q |
113 |
taatagatagggnnnnnnnnnnnnnactggcacttccctcaacatgttttggactctttccctaacctgaatcaacttgtcatgcaagtatctctcccca |
212 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| | |
|
|
| T |
27448034 |
taatagatagggtttctgattttttaccggcacttccctcaacatgttttggactctttccctaacctgaatcaacttgtcatgcaagtaactctcccta |
27448133 |
T |
 |
| Q |
213 |
gtgagcctaaggaagacaaattagtttggaaaagaaactcaacatgagatctttctattaaggaggctttttcattcaaatatggcacatgacaaaatat |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || |||| ||||||||||| |||| ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
27448134 |
gtgagcctaaggaagacaaattagtttggaaaagatgctaaacaggagatctttctcttaaagaggctttttcattcaaatatggcacaggacaaaatat |
27448233 |
T |
 |
| Q |
313 |
ttcttgggcaaaaactctacggtgccct |
340 |
Q |
| |
|
||||||||||||||| ||| |||||||| |
|
|
| T |
27448234 |
ttcttgggcaaaaacgctatggtgccct |
27448261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 13 - 124
Target Start/End: Original strand, 27460286 - 27460396
Alignment:
| Q |
13 |
atcataggtaatggggaaaatatcattttttggcttgatccctggcttgacaaatctgttgcttttattcttaacttgccaggcaacgttcatagcagtt |
112 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| ||||||||| || ||||||||| |||||||||||||||||||||| ||||||| |||| |
|
|
| T |
27460286 |
atcataggtaatggggaaaatatcaatttttggcttgatccgtggcttgac-aacctgttgcttctattcttaacttgccaggcaacattcatagtagtt |
27460384 |
T |
 |
| Q |
113 |
taatagataggg |
124 |
Q |
| |
|
|||||||||||| |
|
|
| T |
27460385 |
taatagataggg |
27460396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 13 - 66
Target Start/End: Original strand, 48709435 - 48709488
Alignment:
| Q |
13 |
atcataggtaatggggaaaatatcattttttggcttgatccctggcttgacaaa |
66 |
Q |
| |
|
|||||||||||||| || ||||| | ||||||||||||| ||||| |||||||| |
|
|
| T |
48709435 |
atcataggtaatggagagaatattaatttttggcttgatacctggattgacaaa |
48709488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University