View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1318_low_80 (Length: 350)
Name: NF1318_low_80
Description: NF1318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1318_low_80 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 31 - 342
Target Start/End: Complemental strand, 7087918 - 7087607
Alignment:
| Q |
31 |
ggtcaaacaggctattagaaactcttacaaagttagatctttcggttaatcatcttcaagggaatattcctgcagaaattggtctgctttcaaagttgag |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7087918 |
ggtcaaacaggctattagaaactcttacaaagttagatctttcggttaatcatcttcaagggaatattcctgcagaaattggtctgctttcaaagttgag |
7087819 |
T |
|
| Q |
131 |
attcttgaatttgtcttggaatgatcttcattctcagattccacctgaatttggtcttctgcagaatcttgaagttttggatcttcgtaatagcgcgttg |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7087818 |
attcttgaatttgtcttggaatgatcttcattctcagattccacctgaatttggtcttctgcagaatcttgaagttttggatcttcgtaatagcgcgttg |
7087719 |
T |
|
| Q |
231 |
tttggttcgattccagaagatacatgtgattcaggcaatttagctgttcttcaattggatggaaattcattgaagggatctattcctgaaaagattggga |
330 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7087718 |
tttggttcgattccagaagatacatgtgattcaggcaatttggctgttcttcaattggatggaaattcattgaagggatctattcctgaaaagattggga |
7087619 |
T |
|
| Q |
331 |
attgttcatctc |
342 |
Q |
| |
|
|||||||||||| |
|
|
| T |
7087618 |
attgttcatctc |
7087607 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University