View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1318_low_85 (Length: 337)

Name: NF1318_low_85
Description: NF1318
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1318_low_85
NF1318_low_85
[»] chr1 (2 HSPs)
chr1 (85-283)||(12275210-12275407)
chr1 (129-276)||(14260792-14260939)


Alignment Details
Target: chr1 (Bit Score: 163; Significance: 5e-87; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 163; E-Value: 5e-87
Query Start/End: Original strand, 85 - 283
Target Start/End: Complemental strand, 12275407 - 12275210
Alignment:
85 aaaaatgtcactcaaaagagctaccatggcatgcatacattcattggacaactgccatgtgtgcttttaacattgacttggtatttgtccgtttaacata 184  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||    
12275407 aaaaatgtcactcaaaaaagctaccatggcatgcatacattcattggacaactgccatgtgtgcttttaacattgacttggtatttgtccggttagcata 12275308  T
185 tgaatgttatattgcagggactaattctcatattcgatcatattacagggattaaaaatatatataacttgaaaataaactaccatgaaaatacaatga 283  Q
    ||||||| ||||||||||||||||||| ||||||||||||||||||| |||||||||| ||||||||||||||||||||||| ||||||||||||||||    
12275307 tgaatgtcatattgcagggactaattcccatattcgatcatattaca-ggattaaaaacatatataacttgaaaataaactaacatgaaaatacaatga 12275210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 129 - 276
Target Start/End: Complemental strand, 14260939 - 14260792
Alignment:
129 tggacaactgccatgtgtgcttttaacattgacttggtatttgtccgtttaacatatgaatgttatattgcagggactaattctcatattcgatcatatt 228  Q
    |||||||||| || ||||||||||||||||||||||||||||||||  ||| || ||| |||| ||||||||||||||||| | | |||||  |||||||    
14260939 tggacaactgtcacgtgtgcttttaacattgacttggtatttgtccaattagcagatgtatgtcatattgcagggactaatacccgtattcactcatatt 14260840  T
229 acagggattaaaaatatatataacttgaaaataaactaccatgaaaat 276  Q
    | |||||| ||||| |||||||||| ||||||||||||||||||||||    
14260839 atagggataaaaaacatatataactcgaaaataaactaccatgaaaat 14260792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University