View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13190_high_11 (Length: 274)
Name: NF13190_high_11
Description: NF13190
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13190_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 20 - 257
Target Start/End: Original strand, 48890197 - 48890434
Alignment:
| Q |
20 |
gtttcacactgcacgtgtaaactgtcttgcttggtcacctaatagcaaactggtagctactggttcacttgatacatgtgttattgtatacgaaattgga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48890197 |
gtttcacactgcacgtgtaaactgtcttgcttggtcacctaatagcaaactggtagctactggttcacttgatacatgtgttattgtatacgaaattgga |
48890296 |
T |
 |
| Q |
120 |
aagccagcatcaagccgcagaaccataaaaggggctcatttaggtggagtgtatggcttgacttttattgagccagaaagagtggtcagttcgggagaag |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48890297 |
aagccagcatcaagccgcagaaccataaaaggggctcatttaggtggagtgtatggcttgacttttattgagccagaaagagtggtcagttcgggagaag |
48890396 |
T |
 |
| Q |
220 |
atagttgcgttcgtgtttgggatttaatttcagaataa |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48890397 |
atagttgcgttcgtgtttgggatttaatttcagaataa |
48890434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University