View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13192_low_3 (Length: 296)
Name: NF13192_low_3
Description: NF13192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13192_low_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 155 - 281
Target Start/End: Original strand, 17378577 - 17378702
Alignment:
| Q |
155 |
atccgtgcttcatagccggtaagaatttgacgaaataaaacaattgaatgaaaccgcatgtactagtttcatgtcggcaacgaatactgaacacgatttt |
254 |
Q |
| |
|
|||||||||||||||| ||||| ||| |||| |||||||| ||||||||||||| || || |||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
17378577 |
atccgtgcttcatagc-ggtaacaatgtgacaaaataaaataattgaatgaaactgcgtgcactagtgtcatgttggcaacgaataccgaacacgatttc |
17378675 |
T |
|
| Q |
255 |
tatgtgatgtatcggtgctacatattg |
281 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
17378676 |
aatgtgatgtatcggtgctacatattg |
17378702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 28 - 102
Target Start/End: Original strand, 17393336 - 17393410
Alignment:
| Q |
28 |
gtgtccccgtgtctaacacgcgtcagtgtccaccaccgacacatatgattatgcggttttctcaaattattggcg |
102 |
Q |
| |
|
||||||| ||||| |||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17393336 |
gtgtcccggtgtcggacacacgtcggtgtccaccaccgacacatatgattatgcggttttctcaaattattggcg |
17393410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University