View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13192_low_6 (Length: 254)
Name: NF13192_low_6
Description: NF13192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13192_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 253
Target Start/End: Original strand, 25011466 - 25011720
Alignment:
| Q |
1 |
ctggcgaaactagtatatctgaaa-cacgttgctttgtcaaattatcgtttcgtgtaagtgctatacactattcgaagaattccacaggattgaagagta |
99 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25011466 |
ctggtgaaactagtatatctgaaaacacgttgctttgtcaaattatcgtttcgaaaaagtgctatacactattcgaagaattccacaggattgaagagta |
25011565 |
T |
 |
| Q |
100 |
agtttgaagagaaattattgaaaccgtcaagttgagtactcacagagtgaagaatccctttggttgtaacatcaaatgcacctgcagtaccaccagcagc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25011566 |
agtttgaagagaaattattgaaaccgtcaagttgagtactcacagagtgaagaatccctttggttgtaacatcaaatgcacctgcagtaccaccagcagc |
25011665 |
T |
 |
| Q |
200 |
actgatccagtcaacgatcctctgcctgtgtgcatcttgatgatg-tccatctca |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
25011666 |
actgatccagtcaacgatcctctgcctgtgtgcatcttgattatgatccatctca |
25011720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University