View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13192_low_7 (Length: 247)
Name: NF13192_low_7
Description: NF13192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13192_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 17 - 237
Target Start/End: Complemental strand, 7533700 - 7533483
Alignment:
| Q |
17 |
acatatactaagccaacatatggtgtgcacataggacaaattttacacatgattggtctgtttcaatttgattagtttagataagaaccgatcgtatatt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7533700 |
acatatactaagccaacatatggtgtgcacataggacaaattttacacatgattggtttgtttcaatttgattagtttagataagaaccgatcgtatatt |
7533601 |
T |
|
| Q |
117 |
cgaactgggtaacaaagcggtccaatctattattatcatatatacagaactaatttgtaaaattcaaacttcaacttgtcaaatatcttaatctttgcta |
216 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
7533600 |
cgaactgggtaacgaagcggtccaatcta---ttatcatatatacagaactaatttgtaaaattcaaacttcaacttgtcaaatatcttaatctttgcca |
7533504 |
T |
|
| Q |
217 |
cataaattttgtcatcctatg |
237 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
7533503 |
cataaattttgtcatcctatg |
7533483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University