View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13192_low_8 (Length: 235)
Name: NF13192_low_8
Description: NF13192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13192_low_8 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 16 - 235
Target Start/End: Original strand, 52888341 - 52888560
Alignment:
| Q |
16 |
aaatcatcaccaccatgttcatggagtcgaacatcacaaacatcttcttcaccttcttcaacaatctccgaatcaagcaattcaccacttgcaatctaca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52888341 |
aaatcatcaccaccatgttcatggagtcgaacatcacaaacatcttcttcaccttcttcaacaatctccgaatcaagcaattcaccacttgcaatctaca |
52888440 |
T |
|
| Q |
116 |
ccactaaacccagaaccccaagaaaacgacccaatcaaacctacaacgaagctgcaacactccttaacaccgcatacccaaacctcttctccaatccaaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52888441 |
ccactaaacccagaaccccaagaaaacgacccaatcaaacctacaacgaagctgcaacactccttaacaccgcatacccaaacctcttctccaatccaaa |
52888540 |
T |
|
| Q |
216 |
cctcaaaacaaacccaaacc |
235 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
52888541 |
tctcaaaacaaacccaaacc |
52888560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University