View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13193_high_1 (Length: 687)

Name: NF13193_high_1
Description: NF13193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13193_high_1
NF13193_high_1
[»] chr1 (1 HSPs)
chr1 (210-268)||(19230848-19230906)


Alignment Details
Target: chr1 (Bit Score: 51; Significance: 7e-20; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 51; E-Value: 7e-20
Query Start/End: Original strand, 210 - 268
Target Start/End: Original strand, 19230848 - 19230906
Alignment:
210 aatgttctaagctctttttaggtgttatatatctcattgtgtactggtttagcataaaa 268  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||    
19230848 aatgttttaagctctttttaggtgttatatatctcattgtgtactggtttaccataaaa 19230906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University