View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13193_high_1 (Length: 687)
Name: NF13193_high_1
Description: NF13193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13193_high_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 51; Significance: 7e-20; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 51; E-Value: 7e-20
Query Start/End: Original strand, 210 - 268
Target Start/End: Original strand, 19230848 - 19230906
Alignment:
| Q |
210 |
aatgttctaagctctttttaggtgttatatatctcattgtgtactggtttagcataaaa |
268 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
19230848 |
aatgttttaagctctttttaggtgttatatatctcattgtgtactggtttaccataaaa |
19230906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University