View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13193_high_13 (Length: 237)
Name: NF13193_high_13
Description: NF13193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13193_high_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 14 - 215
Target Start/End: Complemental strand, 28370771 - 28370567
Alignment:
| Q |
14 |
agaagcaaaggtaacattaattatcaacgaaaaaagaggttagatcaacgaaattcaacaagaagcatagttgaaacttaatgtatgtgtgactttcgga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28370771 |
agaagcaaaggtaacattaattatcaacgaaaaaagaggttagatcaacgaaattcaacaagaagcatagttgaaacttaatgtatgtgtgactttcgga |
28370672 |
T |
 |
| Q |
114 |
cacagtcaccgagtagaagaaga---agaatcaaattgaaagggaatgtttggagtgaaaagaaaatcaactttagtgggtttggcttttctaatgttca |
210 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28370671 |
cacagtcaccgagtagaagaagaagaagaatcaaattgaaagggaatgtttggagtgaaaagaaaatcaactttagtgggtttggcttttctaatgttca |
28370572 |
T |
 |
| Q |
211 |
tgggt |
215 |
Q |
| |
|
||||| |
|
|
| T |
28370571 |
tgggt |
28370567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University