View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13193_high_15 (Length: 211)
Name: NF13193_high_15
Description: NF13193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13193_high_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 15 - 182
Target Start/End: Original strand, 39195778 - 39195945
Alignment:
| Q |
15 |
agttctcactgtttacggcggacgacgaccaacttcgcatgtattttccggcgaggttctcgttttccggccagcgtttggtttgagttcagcgtgaatc |
114 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39195778 |
agttctcactgtttacggcggacgaagaccaacttcgcatgtattttccggcgaggttctcgttttccggccagcgtttggtttgagttcagcgtgaatc |
39195877 |
T |
 |
| Q |
115 |
caactagactagtttctgatggaacaaagggtaaagcagctgcatttttttgttgaaatggggtttta |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39195878 |
caactagactagtttctgatggaacaaagggtaaagcagctgcatttttttgttgaaatggggtttta |
39195945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University