View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13193_low_13 (Length: 238)

Name: NF13193_low_13
Description: NF13193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13193_low_13
NF13193_low_13
[»] chr1 (1 HSPs)
chr1 (81-128)||(12470272-12470319)


Alignment Details
Target: chr1 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 81 - 128
Target Start/End: Complemental strand, 12470319 - 12470272
Alignment:
81 cgacacacaaaggaaaggaagagcgatggaaacagaggaattcaacac 128  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||    
12470319 cgacacacagaggaaaggaagagcgatggaaacagaggaattcaacac 12470272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University