View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13193_low_7 (Length: 294)

Name: NF13193_low_7
Description: NF13193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13193_low_7
NF13193_low_7
[»] chr1 (2 HSPs)
chr1 (12-279)||(14193016-14193289)
chr1 (188-246)||(18521891-18521949)
[»] chr4 (3 HSPs)
chr4 (201-279)||(4591407-4591485)
chr4 (198-271)||(4555103-4555176)
chr4 (196-254)||(4620934-4620992)


Alignment Details
Target: chr1 (Bit Score: 165; Significance: 3e-88; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 12 - 279
Target Start/End: Original strand, 14193016 - 14193289
Alignment:
12 agagatgcaaagccagcaaggcaagagctagttcgatgcgctactaagcttctagctgctgggataatcatcattccagtac---gccaggtgcnnnnnn 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||   ||| ||||           
14193016 agagatgcaaagccagcaaggcaagagctagttcgatgcgctactagtcttctagctgctgggataatcatcattccagtaccctgcctggtggaacgaa 14193115  T
109 ntccggaggtaattgatttgacggatacattcgactttaatataagttttgacgataca---gggaagctaggaatcccggtgttgaatgtcaaggaaac 205  Q
     |||  ||||| |||||||||||||||||||||||||||||||| |||| ||| ||| |   ||| ||||| ||||||||||||||||| ||||||||||    
14193116 atccccaggtacttgatttgacggatacattcgactttaatatacgtttggactatataacgggggagctacgaatcccggtgttgaatttcaaggaaac 14193215  T
206 aacggaagtgaggtggaggaatttgattgcttgggagcagagcaaaattaacattaaatgcaaatatacatcct 279  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
14193216 aacggaagtgaggtggaggaatttgattgcttgggagcagagcaaaattaacattagatgcaaatatacatcct 14193289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 188 - 246
Target Start/End: Original strand, 18521891 - 18521949
Alignment:
188 gttgaatgtcaaggaaacaacggaagtgaggtggaggaatttgattgcttgggagcaga 246  Q
    |||| |||| ||||||||||||||||||| |||||||||||||||||||||||| ||||    
18521891 gttgtatgttaaggaaacaacggaagtgaagtggaggaatttgattgcttgggaacaga 18521949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 47; Significance: 7e-18; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 201 - 279
Target Start/End: Original strand, 4591407 - 4591485
Alignment:
201 gaaacaacggaagtgaggtggaggaatttgattgcttgggagcagagcaaaattaacattaaatgcaaatatacatcct 279  Q
    |||||||||||||||| ||||||||||||||||||||||||||| ||||||| |   |||| ||||||||| |||||||    
4591407 gaaacaacggaagtgaagtggaggaatttgattgcttgggagcaaagcaaaaattggattagatgcaaatacacatcct 4591485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 198 - 271
Target Start/End: Original strand, 4555103 - 4555176
Alignment:
198 aaggaaacaacggaagtgaggtggaggaatttgattgcttgggagcagagcaaaattaacattaaatgcaaata 271  Q
    ||||||| ||||||||||| ||||||||||||||||||||||||||| |||||||||   | ||||||||||||    
4555103 aaggaaagaacggaagtgaagtggaggaatttgattgcttgggagcaaagcaaaatttggagtaaatgcaaata 4555176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 196 - 254
Target Start/End: Original strand, 4620934 - 4620992
Alignment:
196 tcaaggaaacaacggaagtgaggtggaggaatttgattgcttgggagcagagcaaaatt 254  Q
    ||||||||||||| ||||| | ||||||||||||||||||||||||||| |||||||||    
4620934 tcaaggaaacaactgaagttaagtggaggaatttgattgcttgggagcaaagcaaaatt 4620992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University