View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13193_low_7 (Length: 294)
Name: NF13193_low_7
Description: NF13193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13193_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 3e-88; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 12 - 279
Target Start/End: Original strand, 14193016 - 14193289
Alignment:
| Q |
12 |
agagatgcaaagccagcaaggcaagagctagttcgatgcgctactaagcttctagctgctgggataatcatcattccagtac---gccaggtgcnnnnnn |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
14193016 |
agagatgcaaagccagcaaggcaagagctagttcgatgcgctactagtcttctagctgctgggataatcatcattccagtaccctgcctggtggaacgaa |
14193115 |
T |
 |
| Q |
109 |
ntccggaggtaattgatttgacggatacattcgactttaatataagttttgacgataca---gggaagctaggaatcccggtgttgaatgtcaaggaaac |
205 |
Q |
| |
|
||| ||||| |||||||||||||||||||||||||||||||| |||| ||| ||| | ||| ||||| ||||||||||||||||| |||||||||| |
|
|
| T |
14193116 |
atccccaggtacttgatttgacggatacattcgactttaatatacgtttggactatataacgggggagctacgaatcccggtgttgaatttcaaggaaac |
14193215 |
T |
 |
| Q |
206 |
aacggaagtgaggtggaggaatttgattgcttgggagcagagcaaaattaacattaaatgcaaatatacatcct |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
14193216 |
aacggaagtgaggtggaggaatttgattgcttgggagcagagcaaaattaacattagatgcaaatatacatcct |
14193289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 188 - 246
Target Start/End: Original strand, 18521891 - 18521949
Alignment:
| Q |
188 |
gttgaatgtcaaggaaacaacggaagtgaggtggaggaatttgattgcttgggagcaga |
246 |
Q |
| |
|
|||| |||| ||||||||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
18521891 |
gttgtatgttaaggaaacaacggaagtgaagtggaggaatttgattgcttgggaacaga |
18521949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 47; Significance: 7e-18; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 201 - 279
Target Start/End: Original strand, 4591407 - 4591485
Alignment:
| Q |
201 |
gaaacaacggaagtgaggtggaggaatttgattgcttgggagcagagcaaaattaacattaaatgcaaatatacatcct |
279 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| ||||||| | |||| ||||||||| ||||||| |
|
|
| T |
4591407 |
gaaacaacggaagtgaagtggaggaatttgattgcttgggagcaaagcaaaaattggattagatgcaaatacacatcct |
4591485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 198 - 271
Target Start/End: Original strand, 4555103 - 4555176
Alignment:
| Q |
198 |
aaggaaacaacggaagtgaggtggaggaatttgattgcttgggagcagagcaaaattaacattaaatgcaaata |
271 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||||||||||||||| ||||||||| | |||||||||||| |
|
|
| T |
4555103 |
aaggaaagaacggaagtgaagtggaggaatttgattgcttgggagcaaagcaaaatttggagtaaatgcaaata |
4555176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 196 - 254
Target Start/End: Original strand, 4620934 - 4620992
Alignment:
| Q |
196 |
tcaaggaaacaacggaagtgaggtggaggaatttgattgcttgggagcagagcaaaatt |
254 |
Q |
| |
|
||||||||||||| ||||| | ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4620934 |
tcaaggaaacaactgaagttaagtggaggaatttgattgcttgggagcaaagcaaaatt |
4620992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University