View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13193_low_9 (Length: 281)

Name: NF13193_low_9
Description: NF13193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13193_low_9
NF13193_low_9
[»] chr2 (1 HSPs)
chr2 (16-50)||(26541247-26541281)


Alignment Details
Target: chr2 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 16 - 50
Target Start/End: Original strand, 26541247 - 26541281
Alignment:
16 caagtgtcactattgttttctttttctgccacgtt 50  Q
    |||||||||||||||||||||||||||||||||||    
26541247 caagtgtcactattgttttctttttctgccacgtt 26541281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University