View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13194_high_24 (Length: 354)
Name: NF13194_high_24
Description: NF13194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13194_high_24 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 30 - 354
Target Start/End: Original strand, 47116799 - 47117119
Alignment:
| Q |
30 |
gttatttcatttccttatgatatctcnnnnnnnctgacattgttttgtttcatcgcttctcaggtaattacaatagttatattttatcaaagatattcaa |
129 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47116799 |
gttatttcatttccttatgatatctctttttttctgacattgttttgtttcatcgcttctcaggtaattacaatagttatattttatcaaagatattcaa |
47116898 |
T |
|
| Q |
130 |
taaccaatttcttttatatctttagtttcaattcaaggagataaatattcataccttttaacgatcaaatcacaaagcaaggtaagcaacatcaacgtat |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
47116899 |
taaccaatttcttttatatctttagtttcaattcaaggagataaatattcataccttttaacgatcaaatcacaaagcaaggtaagcaatatcaacgtat |
47116998 |
T |
|
| Q |
230 |
caatgactcgatcgatcaccttttaacgattatttttaatttcttgttttgtagatggataggcggagaatgtatgataggcaacaaagctcaacgggaa |
329 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47116999 |
caatgac----tcgatcaccttttaacgattatttttaatttcttgttttgtagatggataggcggagaatgtatgataggcaacaaagctcaacgggaa |
47117094 |
T |
|
| Q |
330 |
cgccaacatcaccatcttcgccggt |
354 |
Q |
| |
|
||||||||||||| ||||| ||||| |
|
|
| T |
47117095 |
cgccaacatcaccgtcttcaccggt |
47117119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University