View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13194_high_25 (Length: 350)
Name: NF13194_high_25
Description: NF13194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13194_high_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 2e-80; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 167 - 330
Target Start/End: Complemental strand, 10379663 - 10379500
Alignment:
| Q |
167 |
gcaacaatttaacactaggtcagaggctcgctgagggcaatgcgagcgatgcaaattcaaaaaacactatcctattaaatataacggaaaaatgcaatat |
266 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
10379663 |
gcaacaatttaacactagttcagaggctcgctgagggcaatgcgagcgatgcaaattcaaaaaacactatcctaataaatataacggaaaaatgcaatat |
10379564 |
T |
 |
| Q |
267 |
atttataaataagccatattatatctagttaaatcaatattgtattattaacatagtgatgatg |
330 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10379563 |
atttataaataagccatattatatctagttaaatcaatattgtactattaacatagtgatgatg |
10379500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 23 - 132
Target Start/End: Complemental strand, 10379800 - 10379691
Alignment:
| Q |
23 |
tcatcaagcatacgagagaggcatcggagagtgttttgagttgcaacagaatgcagttttccatcagatggccatatggaactggcttctccaccctgac |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10379800 |
tcatcaagcatacgagagaggcatcggagagtgttttgagttgcaacagaatgcagttttccatcagatggccatatggaactggcttctccaccctgac |
10379701 |
T |
 |
| Q |
123 |
tctcagttgg |
132 |
Q |
| |
|
|||||||||| |
|
|
| T |
10379700 |
tctcagttgg |
10379691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University