View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13194_high_27 (Length: 340)
Name: NF13194_high_27
Description: NF13194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13194_high_27 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 22 - 340
Target Start/End: Complemental strand, 50214834 - 50214516
Alignment:
| Q |
22 |
gtccctgctcctatctctttccatttctcttctcctatccctaccctcatccctttccctgctcctatcttttaccatgtcccttctatgcctgtcatga |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50214834 |
gtccctgctcctatctctttccatttctcttctcctatccctaccctcatccctttccctgctcctatcttttaccatgtcccttctatgcctgtcatga |
50214735 |
T |
|
| Q |
122 |
ctccttccacgttctttttcccttctatgcacccaatcaacctccttattcctgcttgtttcctctcgcttcttttccctatgcaagtctctatccacat |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50214734 |
ctccttccacgttctttttcccttctatgcacccaatcaacctccttattcctgcttgtttcctctcgcttcttttccctatgcaagtctctatccacat |
50214635 |
T |
|
| Q |
222 |
ctcggtcccgacccctatccttatccatatccttgttcctgttcttatcccgggcctcccgactatgatacctagaactgtgttctcgtctatcgtcttc |
321 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
50214634 |
ctctgtcccgacccctatccttatccatatccttgttcctgttcttatcccgggcctcccgactatgatacctagaactgtgttctcgtctatcatcttc |
50214535 |
T |
|
| Q |
322 |
catcagatccttactgccg |
340 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
50214534 |
catcagatccttactgccg |
50214516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University