View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13194_high_30 (Length: 330)
Name: NF13194_high_30
Description: NF13194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13194_high_30 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 155; Significance: 3e-82; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 164 - 322
Target Start/End: Complemental strand, 35443146 - 35442988
Alignment:
| Q |
164 |
tgtatatttgtatagattgcatttcttctcgtggttttatgcagttggaaattttgtatagaatgaggttttattttttgattagtaaatagtagatagg |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35443146 |
tgtatatttgtatagattgcatttcttctcgtggttttatgcagttggaaattttgtatagaatgaggttttattttttgattagtaaatagtagatagg |
35443047 |
T |
|
| Q |
264 |
gtttgtttggttacaaaatgctaaaaatacatatatttatgtaaaataagtggttaaat |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
35443046 |
gtttgtttggttacaaaatgctaaaaatacatatatttatttaaaataagtggttaaat |
35442988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 10 - 166
Target Start/End: Complemental strand, 35443362 - 35443205
Alignment:
| Q |
10 |
gcaatgcatactcttattactcgtcaagatgttgaccaggtaattaattgacctctctctaatgatatgatacacttcactcattgttgatttagaatag |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35443362 |
gcaatgcatactcttattactcgtcaagatgttgaccaggtaattaattgacctctctctaatgatatgatacacttcactcattgttgatttagaatag |
35443263 |
T |
|
| Q |
110 |
aattttgcgaaaataaacaaaggaatcacctttgttctttacctt-ttttatgtttgt |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
35443262 |
aattttgcgaaaataaacaaaggaatcacctttgttctttacctttttttatgtttgt |
35443205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 288 - 317
Target Start/End: Original strand, 16780329 - 16780358
Alignment:
| Q |
288 |
aaatacatatatttatgtaaaataagtggt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
16780329 |
aaatacatatatttatgtaaaataagtggt |
16780358 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University