View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13194_high_34 (Length: 320)
Name: NF13194_high_34
Description: NF13194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13194_high_34 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 103; Significance: 3e-51; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 30 - 156
Target Start/End: Complemental strand, 16594683 - 16594559
Alignment:
| Q |
30 |
ctcaatcctatccatttttatgtttaattcttttgttttgatttggaacatgtggctttgggttttagatatgagttttttagatccagttgtttgggtt |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
16594683 |
ctcaatcctatccatttttatgtttaattcttttgttttgatttggaacatgtggctatgagttttagatatgagtttttta-atccag-tgtttgggtt |
16594586 |
T |
|
| Q |
130 |
tcaatacattatgttatgtgtctgaac |
156 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
16594585 |
tcaatacattatgttatgtgtctgaac |
16594559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 232 - 318
Target Start/End: Complemental strand, 16594483 - 16594397
Alignment:
| Q |
232 |
ttcatacatttataaatattaattaagttagttaaataaattgaattttttaagttataattgtagttgcccttagtatacttttgt |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
16594483 |
ttcatacatttataaatattaattaagttagttaaataaattgaattttttaagttataattgtagttgcccttagtatgcttttgt |
16594397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University