View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13194_high_41 (Length: 312)
Name: NF13194_high_41
Description: NF13194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13194_high_41 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 1 - 282
Target Start/End: Complemental strand, 39783170 - 39782889
Alignment:
| Q |
1 |
aaagaacaagaatggtacttcaagaatgcaattagtttaactcaaaatgctaatcatcattataaaggtggacaagaaaaggctcaaatcaaatttgatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
39783170 |
aaagaacaagaatggtacttcaagaatgcaattagtttaactcaaaatgctaatcatcatcataaaggtggacaagaaaagactcaaatcaaatttgatc |
39783071 |
T |
|
| Q |
101 |
ttgaaaggcctgcagaggagcacactgcagaatcagatgacgaggagctagagatcatcgacgagactgaaattgagctgacattaggcccgtcgagtta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39783070 |
ttgaaaggcctgcagaggagcacactgcagaatcagatgacgaggggctagagatcatcgacgagactgaaattgagctgacattaggcccgtcgagtta |
39782971 |
T |
|
| Q |
201 |
taaccgtagcaagaaaattgaaacaccactaacttcagaatcaggacatagtttgtcttcatcttcaactggatcaagtgat |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39782970 |
taaccgtagcaagaaaattgaaacaccactaacttcagaatcaggacatagtttgtcttcatcttcaactggatcaagtgat |
39782889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University