View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13196_high_13 (Length: 292)
Name: NF13196_high_13
Description: NF13196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13196_high_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 275
Target Start/End: Complemental strand, 29548583 - 29548298
Alignment:
| Q |
1 |
gatagaaggaagaggatgcagattgttgagtttatgaataaaatagttcnnnnnnnataatgtggacctgccatgtcagtacttaactgctacctcaann |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
29548583 |
gatagaaggaagaggatgcagattgttgagtttatgaacaaaatagttctttttttataatgtggacctaccatgtcagtacttaactgctacctcaatt |
29548484 |
T |
 |
| Q |
101 |
nnnnn-aacgaaaagggtaacgatgcaaacaattgatgagttaaaagatttatgtgtgaacaaaataacttcgaggtgatttg----------tgcttaa |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
29548483 |
ttttttaacgaaaagggtaacgatgcaaacaattgatgagttaaaagatttatgtgtgaacaaaataacttcgaggtgattgggagcatttgatgcttaa |
29548384 |
T |
 |
| Q |
190 |
agttttgtctaaagtgaagaatattatttgccgtgtgtgcatgaatgtgttgttaactcgtagattacatttgagagaacgcagtg |
275 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29548383 |
agttttgtctatagtgaagaatattatttgccgtgtgtgcatgaatgtgttgttaactcgtagattacatttgagagaacgcagtg |
29548298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 110 - 170
Target Start/End: Original strand, 21353581 - 21353641
Alignment:
| Q |
110 |
aaaagggtaacgatgcaaacaattgatgagttaaaagatttatgtgtgaacaaaataactt |
170 |
Q |
| |
|
||||| ||||||||| |||| |||| |||||||| || |||||||||||||| ||||||| |
|
|
| T |
21353581 |
aaaagcgtaacgatgtaaacggttgaagagttaaatgacttatgtgtgaacaacataactt |
21353641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University