View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13196_high_15 (Length: 285)
Name: NF13196_high_15
Description: NF13196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13196_high_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 13 - 269
Target Start/End: Complemental strand, 39305663 - 39305407
Alignment:
| Q |
13 |
aatatacagccacgtaagggtgcacttttactcaattataagaccctactcttccaaaaagaaaacatatttatttttgtgtggggttaaaagtacatgc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39305663 |
aatatacagccacgtaagggtgcacttttactcaattataagaccctactcttccaaaaagaaaacatatttatttttgtgtggggttaaaagtacatgc |
39305564 |
T |
|
| Q |
113 |
acccgcatatatgttttctaatatcatgtgnnnnnnnctttgggggccaagcgtgctatgtagaagccaaaatgaaatttattggctttagctttggctt |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
39305563 |
acccgcatatatgttttcaaatatcatgtgaaaaaaactttgggggccaagcgtgctatgtagaagccaaaatgaaatttattggctttggctttggctt |
39305464 |
T |
|
| Q |
213 |
tctagtctggtttttccactcatgtcttctcctttctcttcccaattgctgaaaaat |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39305463 |
tctagtctggtttttccactcatgtcttctcctttctcttcccaattgctgaaaaat |
39305407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University